Reproduction (Edexcel GCSE Biology): Exam Questions

Exam code: 1BI0

3 hours20 questions
1a
Sme Calculator
3 marks

Figure 1 shows part of a DNA molecule.

fig-2-1bio-1f-june18-qp-gcse-bio

Figure 1

(i) What is the shape of a DNA molecule?

(1)

A

single helix 

B

double helix

C

complementary helix 

D

triple helix 

(ii) Which molecules are present in the DNA backbone?

(1)

A

sugars and phosphates

B

amino acids and bases 

C

sugars and bases

D

amino acids and phosphates 

(iii) State the type of bond that joins the bases together in the DNA molecule.

(1) 

1b
Sme Calculator
2 marks

DNA can be extracted from fruit.  

Describe how cells are broken down to release DNA.

1c
Sme Calculator
2 marks

In 2003, scientists finished sequencing the 3 billion base pairs in the human genome.

State two benefits that the Human Genome Project could have for medicine.

2a
Sme Calculator
5 marks

Mitosis and meiosis are two types of cell division. 

Complete the table by identifying whether the statements in the table are describing mitosis or meiosis.

The first one has been done for you. 

(5)

 

Mitosis or meiosis?

How gametes are made

Meiosis

Produces four daughter cells

 

How fertilised egg cells divide

 

Daughter cells contain half the number of chromosomes as the parent cell

 

Occurs during asexual reproduction

 

Required for growth

 

2b
Sme Calculator
1 mark

In humans, the gametes are the egg and sperm cells. 

How many chromosomes are contained in each gamete?

2c
Sme Calculator
1 mark

Separate: Biology Only

When the gametes fuse together at fertilisation, the new cell that is produced is genetically different to each of the parents' cells. 

What is the new cell called? 

2d
Sme Calculator
2 marks

Identical twins come from one fertilised egg splitting into two embryos. This means that they have the same DNA as each other. 

Although they are genetically identical, identical twins don't often look the same as each other. 

Why is this the case?

3a
Sme Calculator
1 mark

Figure 1 shows a single strand of DNA with the bases labelled. 

dna-strand-1

Figure 1

State the sequence of DNA bases that would be found on the opposite strand to the one shown in Figure 1.

3b
Sme Calculator
1 mark

Higher Tier Only

How many amino acids does the DNA strand in Figure 1 code for? 

3c
Sme Calculator
3 marks

Higher Tier Only

Put the statements below into the correct order to describe how the DNA strand in Figure 1 is used to synthesize a functioning protein. 

When the protein chain is complete it folds up to form a unique shape.

A template copy of the DNA strand is made.

Carrier molecules bring the amino acids to the ribosome to add to the growing protein chain.

Each amino acid is specific and matches the triplet code on the template to ensure they are in the correct order.

3d
Sme Calculator
3 marks

Higher Tier Only

This section of DNA is a gene that codes for an enzyme. 

Describe how a mutation in this gene might result in the enzyme not functioning anymore. 

4a
Sme Calculator
5 marks

Higher Tier Only

RNA plays a pivotal role in cellular processes.

Define RNA and briefly describe its role in cellular activities.

4b
Sme Calculator
3 marks

Higher Tier Only

Fill in the blanks in Table 1 below.

Table 1

RNA

Full name

Function

 

Messenger RNA

 

tRNA

 

 

 

 

Forms an essential part of ribosomes, facilitating the assembly of amino acids into proteins.

4c
Sme Calculator
3 marks

Higher Tier Only

Indicate the location of the three types of RNA.

4d
Sme Calculator
1 mark

Higher Tier Only

Explain why RNA is the only molecule that can leave the nucleus and enter the cytoplasm.

5a
Sme Calculator
1 mark

List the four bases involved in complementary base pairing in DNA.

A

Adenine, Thymine, Cytosine, Guanine

B

Adenine, Uracil, Cytosine, Guanine

C

Adenine, Thymidine, Cytosine, Guanine

D

Adenine, Thymine, Uracil, Guanine

5b
Sme Calculator
2 marks

A gene's template strand contains the following sequence CCGGATGCAAATTTC. 

Determine the number of amino acids and identify the codons within the sequence.

5c
Sme Calculator
2 marks

Higher Tier Only

List two different types of proteins while providing a brief function for each.

5d
Sme Calculator
3 marks

Higher Tier Only

Non-coding DNA plays a role in gene expression and has significant effects on an organism's traits.

Suggest how genetic variants in non-coding DNA can influence the phenotype of an organism.

1a
Sme Calculator
4 marks

State two advantages and two disadvantages of asexual reproduction.

1b
Sme Calculator
3 marks

Many plants such as strawberry plants grow runners that are special stems that grow out from the adult plant. New plants grow on these 'runner' stems.

The new plants will all have the same inherited characteristics of the original parent plant.

Use words from the box to complete the following statements.

Mitosis

Embryo

Sexual

Asexual

Offspring

Gametes

Genes

Body

Differentiation

Parent

(1) The  ________ plants are produced by ________ reproduction

(2) In this type of reproduction,  ________ cells divide by ________ 

(3) The new plants have the same ________ as the ________ plants

1c
Sme Calculator
6 marks

Hydra are small water animals that can reproduce through both sexual and asexual reproduction.

Figure 1 shows a Hydra in various stages of asexual reproduction.

GGBOUb~4_1

Figure 1

(i) Explain why the offspring in Figure 1 (stage 4) will be genetically identical to the parent.

(3)

(ii) Hydra reproduces asexually when conditions are favourable to do so. If conditions change and become unfavourable they will switch to sexual reproduction.

Explain how the ability to reproduce both asexually and sexually helps Hydra to survive.

(3)

2a
Sme Calculator
4 marks

Describe some of the differences between sexual and asexual reproduction.

2b
Sme Calculator
4 marks

Describe some natural methods of cloning in eukaryotes.

2c
Sme Calculator
5 marks

The skin is the largest organ of the human body.

Skin cells are constantly undergoing cell division so that the outer dead cells are replaced.

(i) State the type of cell division that occurs in skin cells to replace those cells that are lost.

(1)

(ii) In the average adult human male, sperm are continually produced in the testicles by a process known as spermatogenesis.

Every second, around 1500 new sperm cells are made.

Calculate how many sperm cells are produced by an average adult male in 365 days.

Write your answer in standard form.

(3)

(iii) State the type of cell division that produces mature sperm cells

(1)

3a
Sme Calculator
2 marks

Explain why the following statement does not accurately describe gametes (sex cells):

"Gametes are diploid cells produced by mitosis."

3b
Sme Calculator
6 marks

Compare and contrast the type of cell division that occurs in the testes with that that occurs in the skin in human males.

3c
Sme Calculator
3 marks

Explain why gametes need to be produced by meiosis and not mitosis

4a
Sme Calculator
5 marks

DNA is a polymer made from four different nucleotides.

(i) Describe the components of a nucleotide.

(1)

(ii) State which term is used to describe the shape of DNA.

(1)

(iii) Describe how the structure of DNA results from 'complimentary base pairing'.

(3)

4b
Sme Calculator
3 marks

Some students extracted DNA from strawberries using the following method:

  1. In a beaker, gently mash up 50g of strawberries in soapy water

  2. Place the beaker in a water bath at 60 °C for 15 mins

  3. Filter the mixture into a boiling tube

  4. Add two drops of protease enzyme

  5. Slowly pour ice cold ethanol into the strawberry filtrate

  6. Leave the tube for five minutes

  7. Remove DNA with a glass stirring rod

(i) Suggest why the protease solution was added in step 4.

(1)

(ii) Suggest why ethanol was added in step 5.

(1)

(iii) Strawberries are octoploid which means they have eight complete sets of chromosomes.

Suggest why this is beneficial in this type of experiment.

(1)

5
Sme Calculator
7 marks

Figure 1 shows the structure of a DNA nucleotide.

fig-17-1bio-1h-june18-qp-gcse-bio

Figure 1

(i) Structure A is a

(1)

A

base

B

phosphate

C

sugar

D

polymer 

(ii) In 2003, the first complete human genome was sequenced.

The genomes of different people have small changes in the sequence of the DNA bases.

Describe how these changes in DNA sequence can affect the individuals and how sequencing a person’s genome could influence their medical treatments.

(6)

6a
Sme Calculator
2 marks

A scientist obtained a mass of 0.0062 nanograms of DNA from a diploid human cell.

Calculate the mass of DNA the scientist should obtain from a haploid human cell.

Give your answer in picograms.

(1 nanogram = 1000 picograms)

........................................ picograms

6b
Sme Calculator
4 marks

A student used the method shown in Figure 1 to compare the mass of DNA extracted from strawberry fruit cells and from kiwi fruit cells.

fig-3-1bio-1h-june19-qp-gcse-bio

Figure 1

(i) State why ethanol is used.

(1)

(ii) State two variables the student needs to control when using this method to compare the mass of DNA from these two fruits.

(2)

1...........................................
2...........................................

(iii) The student repeated the experiment.

Give one reason why.

(1)

7
Sme Calculator
3 marks

Higher Tier Only

Transcription and translation are stages in the synthesis of proteins.

(i) Which enzyme is involved in the process of transcription?

(1)

A

DNA ligase

B

lysozyme

C

RNA polymerase 

D

restriction endonuclease

(ii) Describe how a mutation in the non-coding region of the DNA can prevent a gene being transcribed.

(2)

86 marks

Discuss the advantages and disadvantages of sexual reproduction and asexual reproduction.

9a2 marks

Figure 1 shows a sperm cell.

fig-13-1bio-1h-nov2021-qp-gcse-bio

Figure 1

Describe how structure A and structure B enable fertilisation.

structure A........................................

structure B.........................................

9b3 marks

Figure 2 shows a human egg cell, magnified ×700.

3-1-egg-cell-

Figure 2

Calculate the actual width of the region indicated by the line on Figure 2.

Give your answer in millimetres, in standard form.

.............................................................. mm

10a
Sme Calculator
3 marks

James Watson and Francis Crick built a model that showed that DNA has a double helix structure.

(i) Which statement about DNA is correct?

(1)

A

each pair of bases is joined by hydrogen bonds

B

phosphate groups are joined by hydrogen bonds 

C

nucleotides consist of a sugar and a phosphate group only

D

bases are joined to phosphate molecules

(ii) Figure 1 shows the percentage of each base in human DNA.

(2)

fig-13-1bio-1f-june19-qp-gcse-bio

Figure 1

Describe how this data provides evidence for base pairing in DNA.

10b
Sme Calculator
3 marks

Mitosis and meiosis are processes that produce new cells.

Compare the outcomes of mitosis and meiosis.

1a
Sme Calculator
7 marks

Figure 1 shows a strand of a molecule of DNA with the four bases represented by the letter A, B, C and D

Figure 1

hypothetical-gene

The chain of bases shown in Figure 1 acts as a 'hypothetical' gene for the synthesis of haemoglobin. 

(i) Describe what a gene is.

(1)

Higher Tier only

(ii) Explain how the chain of bases shown in Figure 1 leads to the production of haemoglobin in the cell.

(6)

1b
Sme Calculator
3 marks

Higher Tier only

Figure 2 shows the partial DNA sequence of a gene that codes for a protein.

The coding strand and template strand are shown. 

Coding strand

ATGGGGCTCCGGAGCGACGCT

Template strand

TACCCCGAGGCCTCGCTGCGA

Figure 2

(i) Explain how many amino acids this partial sequence codes for.

(2)

(ii) State what the sequence of bases would be in the complementary mRNA strand.

(1)

1c
Sme Calculator
5 marks

Higher Tier only

Figure 3 shows the partial DNA sequence of a gene that codes for a normal functional protein.

There is a variant form of this gene that has a single base change from G to A as shown in Figure 3.

Normal sequence

Coding strand

ATGGGGCTCCGGAGCGACGCT

Template strand

TACCCCGAGGCCTCGCTGCGA

Variant sequence

Coding strand

ATGGGGCTCCAGAGCGACGCT

Template strand

TACCCCGAGGTCTCGCTGCGA

.

Figure 3

(i) State another term that can be used to describe the change in base sequence.

(1)

(ii) State two factors that can lead to such changes in the base sequence of DNA.

(2)

(iii) Explain why the base change could result in a non-functioning protein.

(2)

2a
Sme Calculator
4 marks

The daffodil (Narcissus pseudonarcissus) is a well known native plant to many parts of the UK. 

Daffodils can reproduce in two ways:

  • Asexually by cloning their bulbs

  • Sexually through the process of pollination

(i) Explain why it is an advantage to the daffodil to be able to reproduce sexually.

(2)

(ii) Suggest why gardeners who grow daffodils might see the process of asexual reproduction as an advantage.

(2)

2b
Sme Calculator
4 marks

A scientist wanted to compare two different types of cell taken from a daffodil.

Complete Table 1 below to show the differences between the types of cells.

Put a tick (✓) in the relevant boxes.

Table 1

 

Pollen cell

Palisade cell

Is a haploid cell

 

 

Contains a nucleus

 

 

Is produced by meiosis

 

 

Is genetically identical to other cells made in the same process

 

 

2c
Sme Calculator
7 marks

(i) A student was investigating mitosis in the root of a daffodil plant.

Describe how the student could prepare a microscope slide to show mitosis in the growing roots of the plant.

(4)

Polyploidy is when a cell or organism has additional sets of chromosomes, along with the copies of chromosomes from the biological parents. This is a common phenomenon in plants.

Figure 1 shows an example of the effects of polyploidy in a strawberry plant.

3-1-reproduction-hard-2

Figure 1

(i) Suggest how polyploidy could have arisen in a strawberry plant

(2)

(iii) Suggest what advantages polyploidy might have to crop growers.

(1)

3a
Sme Calculator
5 marks

Mitosis and meiosis are two types of cell division.

(i) State the stage of the cell cycle during which DNA replication occurs.

(1)

(ii) Explain why DNA replication is an important part of the cell cycle.

(1)

(iii) Describe three differences between the processes of mitosis and meiosis.

(3)

3b
Sme Calculator
5 marks

Fern plants inhabit most continents on Earth. They are non-flowering plants and reproduce by producing spores. 

The diagram in Figure 1 shows some of the cell divisions that occur during fern reproduction. 

In the diagram, n represents haploid cells and 2n represents diploid cells.

3-1-edexcel-gcse-3-1h-sq-q3-meiosis-in-ferns

Figure 1

(i) Once a sporophyte has been formed, the cycle starts again.

Name the type of cell division that would form cell A from cell D in order to restart the process.

(1)

(ii) Explain the evidence from Figure 1 that led to the answer given in part (i)

(1)

(iii) Cell C contains 720 chromosomes.

Calculate how many chromosomes cell B has.

(1)

(iv) Explain why it is important that cell B has the number of chromosomes you stated in part (iii).

(2)

3c
Sme Calculator
7 marks

Figure 2 below shows Cell 1 undergoing meiosis. Stages of meiosis are similar to stages of mitosis.

3-1-edexcel-gcse-3-1h-sq-q3c-meiosis

Figure 2

(i) Suggest what stage of meiosis Cell 1 is in.

(1)

(ii) Explain your answer to part (i)

(2)

(iii) Explain how meiosis contributes to genetic variation and suggest why variation is important.

(4)

4a
Sme Calculator
4 marks

Higher Tier Only

In 2022, an estimated 6.4 million people in the UK smoked cigarettes regularly. 

The diagram in Figure 1 shows part of a DNA molecule of a non-smoker.

3-1-edexcel-gcse-3-1h-sq-q4a-dna-sequence

Figure 1

(i) Write the complementary base code for this section of mRNA in the boxes below.

 

 

 

 

 

 

 

 

 

 

 

 

(2)

(ii) State the maximum number of amino acids that could be coded for by this strand of DNA.

Explain your answer.

(2)

4b
Sme Calculator
5 marks

Higher Tier Only

The diagram in Figure 2 shows part of the same DNA molecule from the same individual after they smoked regularly for 20 years.

3-1-edexcel-gcse-3-1h-sq-q4b-dna-sequence

Figure 2

(i) Explain why the DNA molecule in Figure 2 is different to the DNA molecule in Figure 1.

(2)

The molecule of DNA in Figure 2 codes for an enzyme involved in the process of cell division.

(ii) Explain how the change you described in (i) could affect the process of cell division.

(3)

4c
Sme Calculator
7 marks

Higher Tier Only

Table 1 below shows data from research carried out in the UK to find out if smoking and alcohol use increased the likelihood of changes in DNA sequences. 79 male participants were tested for DNA changes.

The DNA sequence to be studied is found in the p53 protein, which is responsible for cell regulation during the cell cycle. When the protein is working normally it detects cells with damaged DNA and triggers a process called apoptosis which leads to cell death. .

Table 1

Test subject condition

Percentage of test subjects with DNA sequence changes (%)

Smokers and consumed alcohol

58

Smokers but no alcohol use

39

Non-smoker and no alcohol

17

One scientist concluded that smoking and alcohol use increases the chances of cancer development.

(i) Evaluate this conclusion. 

(4)

(ii) Explain how a mutation in the p53 protein might result in the development of cancer.

(3)

5a
Sme Calculator
2 marks

Blood at a crime scene can be tested for DNA.

Explain what type of blood cell the DNA might be found in.

5b
Sme Calculator
2 marks

DNA can be analysed to work out the order of some of the bases.

Figure 1 shows a base sequence taken from blood from a crime scene. There are three suspects in this case, and their base sequences are shown below.

The areas in black are where the base sequences match.

3-1-edexcel-gcse-3-1h-sq-q5-crime-scene-dna-sequence

Figure 1

Suggest which suspect is most likely to have committed the crime. 

Explain your answer.

5c
Sme Calculator
6 marks

Research carried out by Watson and Crick contributed to the current understanding of the structure of DNA. One of the other main contributors towards this understanding was Rosalind Franklin, who managed to photograph an X-ray of a DNA molecule. 

This photograph, known as Photograph 51, is shown in Figure 2 below.

3-1-micrograph

Figure 2

Franklin was able to determine the following from Photograph 51:

  • The molecule had rounded corners

  • The fuzzy borders of the structure vary in darkness

  • There is an ‘X’ shape at the centre of the image

  • There is a set distance between each of the repeating dashes

(i) Suggest what information about the structure of DNA Franklin was able to conclude from Photograph 51.

(3)

The complete human genome was first mapped out in 2003 during the Human Genome Project.

(ii) Explain how the Human Genome Project has contributed to advances in medicine.

(3)

5d
Sme Calculator
5 marks

The flowchart in Figure 3 shows one method for extracting DNA from peas.

3-1-reproduction-hard

Figure 3

(i) Explain why salt is needed for the DNA extraction process.

(1)

(ii) Explain why ethanol is added in Step 5.

(1)

(iii) Explain how protease enzymes work to break down proteins.

(3)